Product category
Fungi
Product type
Yeast
Strain designation
WM779 [CBS 10101]
Type strain
No
Genome sequenced strain
Yes
Isolation source
Cheetah
Geographical isolation
South Africa
Applications
Agricultural research
Product format
Frozen
Storage conditions
-80°C or colder
Specific applications
Biomedical Research and Development Material
Preceptrol
No
Characteristics
Serotype
C
Mating type
alpha
Genotype
VGIV, AFLP7
Morphology
After 3 days at 25°C, haploid cells are mostly globose or ovoidal, single or budding. The cell size ranges from 3-8 µm, but is mostly 3-5 µm in diameter. A slight sediment is present. The colony is white to cream-colored with a smooth, mucoid texture; the margin is entire.
Comments
Reference strain of VG IV, AFLP7 molecular type of C. gattii.
Designated as type strain of Cryptococcus tetragattii Hagen et Boekhout by Hagen at al. (2015)
Handling information
Medium
ATCC Medium 200: YM agar or YM broth
ATCC Medium 28: Emmons' modification of Sabouraud's agar/broth
ATCC Medium 1245: YEPD
Temperature
25-30°C
Atmosphere
Aerobic
Handling procedure
Frozen ampoules packed in dry ice should either be thawed immediately or stored in liquid nitrogen. If liquid nitrogen storage facilities are not available, frozen ampoules may be stored at or below -70°C for approximately one week. Do not under any circumstance store frozen ampoules at refrigerator freezer temperatures (generally -20°C). Storage of frozen material at this temperature will result in the death of the culture.
To thaw a frozen ampoule, place in a 25°C to 30°C water bath, until just thawed (approximately 5 minutes). Immerse the ampoule just sufficient to cover the frozen material. Do not agitate the ampoule.
Immediately after thawing, wipe down ampoule with 70% ethanol and aseptically transfer at least 50 µL (or 2-3 agar cubes) of the content onto a plate or broth with medium recommended.
Incubate the inoculum/strain at the temperature and conditions recommended. Inspect for growth of the inoculum/strain regularly. The sign of viability is noticeable typically after 1-2 days of incubation. However, the time necessary for significant growth will vary from strain to strain.
Handling notes
Additional information on this culture is available on the ATCC® web site at www.atcc.org.
Quality control specifications
Sequenced data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCAGTAGAGAATACTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCGGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAA
D1D2 region of the 28S ribosomal RNA gene
ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGCTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGAC
28S ribosomal RNA gene and intergenic spacer (IGS), partial sequence
ATGGGAACGGGGTGCTGTAAGTGGTAGAGTAGCCTTGTTGCTACGATCCACTGAGGCTAAGCCCTTGTTCTATAGATTTGTCTCTAACATGTTGGGTCTCGGGGGGCTTCCTCTACAGACTTGGATGTAAGGGGCTTTATTACGATGACTTGTCAAAGTGTGGATGACTCCAGGAGAGAGGTCGGGCTGGTAATCAGTAATATCAGTCAGTCATTTCAGCTGGCGTCATCGATACTTTATAAGTCAAACTTATTATTTATTTCATTGTGTAGTAAGTAGGCTCTGGATTACGAGAGACGCTTGCCAGGTTATCGCAAGTTGGCAGTACTCGTATACATACTATTGATGATTTCATGGTCATGGGGGACTTGGCTACTGGGTGCTTGTGTTGCATAATAATAGAGAACCATATCATATGCATGTCGCGGGGGACTTGGCTAAGATGCGTTATGCGGCAAGCAAGTCAATTAGTATTAGTATTATAGTACTAGTATTTGTTACTTTTCCAGTCGTGGGGGACTTTGATAGTGGTAGTGAGCCGGAATGAAAAATGGGTAAATGTGGTATGGATGGTGAGAGGGGGGGGCTGCCAAGTGTATGCAGTGGGTGTGCTTATAGCATAGTCAAGAGGGGATGGGCAATCAAATTTTGAATAGTTGTTGACCCGACCTGACGGTGGCTCTAATAGGCTGGTCAAGCAAACGTTTTAAGTTGAGTCAAGCTCGGTCAAGCAAAGTCTAGAAAAGATTAATGATCACTAAGAATTACTCCAGTCGCGGGGGGCTTGTAAGTTCTCTCGCCCACTGTGGGTCCAGTCT
glycerol-3-phosphate dehydrogenase 1 (GPD1) gene, partial cds
TACTTGCATAAATACAATGGTTGTCAAGGTTGGAATCAACGGTTTCGGTACGTGATCAGTCTCTATCTTAGAATTGCTTCATATGCTACGAATGTGGCTTCCGATATTGTGCGCCGTCCTTGGGTTACTGGTAGCTAATAGTTATGTGATAGGTCGTATCGGTCGAATTGTTCTCAGGTATGCTTTGTGTCATGGGGTAAAACAACCGCATATCTAACCATCAAATTAGAAACGCCATCGAGCATGGAGACCTTGAGGTTGTTGCTGTCAACGAGTGAGTACTCTTAAAAGTGTTAATCTATCAAACAAATTATTTACTTGTCCAAAGCCCTTTCATTGACTTGGACTACATGGTATGATACTTTCTTCCGCACAATTGCTTCGTTTAGTGCTAACTGTAGCATGCGCAGGTTTACATGTTCAAGTACGACTCCGTAAGTCTCTGATGGCTCTAGCGCTCTATATGGCATTTTAACCTCATTCCCAACAGACACATGGTCGCTTCAAGGGTTCTGTCGAGGTTAAGGACGGTAAGCTCTATATCAACAACAAGGCCATTTCCGTCTTCGGCGAGAAGGACCCCGCCAATATCAAGTGGGGTGAGGCTGGTGCCGAGTACATCGTTGAGTCTACCGGTGTCTTCACCACTACCGAAAAGGCCGGTGTCCAT
Verification method
Whole-genome Sequencing
History
Deposited as
Cryptococcus gattii (Vanbreuseghem et Takashio) Kwon-Chung et Boekhout
Synonyms
Cryptococcus neoformans var. gattii Vanbreus. et Takashio
Depositors
KJ Kwon-Chung
Chain of custody
ATCC <-- KJ Kwon-Chung <-- W Meyer <-- V Davis
Type of isolate
Animal
Cross references
GenBank FJ914890 ITS including 5.8S rRNA gene
Legal disclaimers
Intended use
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use.
Warranty
The product is provided 'AS IS' and the viability of ATCC® products is warranted for 30 days from the date of shipment, provided that the customer has stored and handled the product according to the information included on the product information sheet, website, and Certificate of Analysis. For living cultures, ATCC lists the media formulation and reagents that have been found to be effective for the product. While other unspecified media and reagents may also produce satisfactory results, a change in the ATCC and/or depositor-recommended protocols may affect the recovery, growth, and/or function of the product. If an alternative medium formulation or reagent is used, the ATCC warranty for viability is no longer valid. Except as expressly set forth herein, no other warranties of any kind are provided, express or implied, including, but not limited to, any implied warranties of merchantability, fitness for a particular purpose, manufacture according to cGMP standards, typicality, safety, accuracy, and/or noninfringement.
Disclaimers
This product is intended for laboratory research use only. It is not intended for any animal or human therapeutic use, any human or animal consumption, or any diagnostic use. Any proposed commercial use is prohibited without a license from ATCC.
While ATCC uses reasonable efforts to include accurate and up-to-date information on this product sheet, ATCC makes no warranties or representations as to its accuracy. Citations from scientific literature and patents are provided for informational purposes only. ATCC does not warrant that such information has been confirmed to be accurate or complete and the customer bears the sole responsibility of confirming the accuracy and completeness of any such information.
This product is sent on the condition that the customer is responsible for and assumes all risk and responsibility in connection with the receipt, handling, storage, disposal, and use of the ATCC product including without limitation taking all appropriate safety and handling precautions to minimize health or environmental risk. As a condition of receiving the material, the customer agrees that any activity undertaken with the ATCC product and any progeny or modifications will be conducted in compliance with all applicable laws, regulations, and guidelines. This product is provided 'AS IS' with no representations or warranties whatsoever except as expressly set forth herein and in no event shall ATCC, its parents, subsidiaries, directors, officers, agents, employees, assigns, successors, and affiliates be liable for indirect, special, incidental, or consequential damages of any kind in connection with or arising out of the customer's use of the product. While reasonable effort is made to ensure authenticity and reliability of materials on deposit, ATCC is not liable for damages arising from the misidentification or misrepresentation of such materials.